Résultats 1 à 10

Dates de soutenance :


Etablissements :

Valider et fermer
  • Aix-Marseille (3)
  • Toulouse 3 (3)
  • Grenoble Alpes (2)
  • Bordeaux 2 (1)
  • Lyon (1)
  • Lyon, École normale supérieure (1)
  • Montpellier (1)
  • Rouen (1)
  • Sorbonne Paris Cité (1)
  • Tours (1)
  • Université de Tunis El Manar (1)
  • Université normale de la Chine de l'Est (Shanghai) (1)

Etablissements :

Fullscreen

Disciplines :

Valider et fermer
  • Sciences de la Vie (2)
  • Biologie (1)
  • Biologie Santé (1)
  • Biologie cellulaire (1)
  • Biologie moléculaire du développement (1)
  • Biologie. Microbiologie (1)
  • Biotechnologies, cancérologie (1)
  • Génétique (1)
  • Génétique moléculaire (1)
  • Pathologie humaine. Maladies infectieuses (1)
  • Sc. de la vie (1)
  • Sciences biologiques et fondamentales appliquées. Psychologie (1)
  • Sciences du Médicament (1)
  • Virologie (1)

Disciplines :

Fullscreen

Ecoles Doctorales :

Valider et fermer
  • Ecole Doctorale Sciences de la Vie et de la Santé (Marseille) (3)
  • École Doctorale Biologie Santé Biotechnologies (Toulouse) (2)
  • École Doctorale de Biologie Moléculaire Intégrative et Cellulaire (Lyon) (2)
  • École doctorale chimie et science du vivant (Grenoble) (2)
  • Sciences Chimiques et Biologiques pour la Santé (1)
  • École doctorale Bio Sorbonne Paris Cité (Paris) (1)
  • École doctorale Santé, Sciences Biologiques et Chimie du Vivant (Centre-Val de Loire) (1)

Ecoles Doctorales :

Fullscreen

Langues :

Valider et fermer
  • anglais (8)
  • français (7)

Langues :

Fullscreen

Directeurs de thèse :

Valider et fermer
  • Lamballerie Xavier de (2)
  • Bové Joseph Marie (1)
  • Ducos Eric (1)
  • Gadal Olivier (1)
  • Gauthier-Vanacker Karine (1)
  • Geiselmann Johannes (1)
  • Gerlier Denis (1)
  • Jong Hidde de (1)
  • Martin Jean-Pierre (1)
  • Peyrin Eric (1)
  • Ramirez Bertha Cecilia (1)
  • Ravelet Corinne (1)
  • Saint-Pierre Benoît (1)
  • Sordet Olivier (1)
  • Spicuglia Salvatore (1)
  • Tricaud Nicolas (1)
  • Triki Saïda (1)
  • Vincent Alain (1)
  • Wong Jiemin (1)

Directeurs de thèse :

Fullscreen

Domaines :

Valider et fermer
  • Sciences de la vie, biologie, biochimie (11)
  • Médecine et santé (5)
  • Plantes. Botanique (1)

Domaines :

Fullscreen

15 thèses pour "Transcription promoter"

Sciences biologiques et fondamentales appliquées. Psychologie

Soutenue en 1994
thèse soutenue

...immature transcription, promoter and exon usage were differentially affected in the IKE120-deleted cells...

Accéder en ligne

...transcription of the viral genome using an appropriate transcription promoter and terminator. Here, we propose...

Accéder en ligne

...: Effect of FLV treatment on antisense transcription. Promoter-associated antisense transcripts were...

Accéder en ligne

...andcontaining the T7 transcription promoter (underlined)5′TAATACGACTCACTATAGGTTACCAGCCTTCACTGC were used for PCR...

Accéder en ligne

...) synthesizes gene products after binding totarget sequences either by transcription (promoter on the DNA), or...

Accéder en ligne
Sciences de la Vie

Soutenue le 06-07-2017
thèse soutenue

...IRES-GFP cassette that ensures co-expression of GFP from the same CMV transcription promoter. pX459-TET...

Accéder en ligne

Résultats 1 à 10