Résultats 1 à 7

Dates de soutenance :


Etablissements :

Valider et fermer
  • Tours (4)
  • Paris 11 (1)
  • Paris 5 (1)
  • Université Paris-Saclay (ComUE) (1)

Etablissements :

Fullscreen

Disciplines :

Valider et fermer
  • Sciences de la Vie et de la Santé (3)
  • Sciences de la vie et de la santé (2)
  • Cancérologie (1)
  • Génétique (1)

Disciplines :

Fullscreen

Ecoles Doctorales :

Valider et fermer
  • École doctorale Santé, Sciences Biologiques et Chimie du Vivant (Centre-Val de Loire) (3)
  • Ecole doctorale Cancérologie : Biologie, Médecine, Santé (2000-2015 ; Le Kremlin-Bicêtre, Val-de-Marne) (1)
  • Ecole doctorale Santé, sciences, technologies (Tours) (1)
  • École doctorale Cancérologie, Biologie, Médecine, Santé (Villejuif, Val-de-Marne ; 2015-....) (1)
  • École doctorale Génétique, cellulaire, immunologie, infectiologie et développement (....-2013 ; Paris) (1)

Ecoles Doctorales :

Fullscreen

Langues :

Valider et fermer
  • français (5)
  • anglais (3)

Langues :

Fullscreen

Directeurs de thèse :

Valider et fermer
  • Andrès Christian (2)
  • Laumonnier Frédéric (2)
  • Bourgeron Thomas (1)
  • Delattre Olivier (1)
  • Hleihel Walid (1)
  • Reyal Fabien (1)

Directeurs de thèse :

Fullscreen

Domaines :

Valider et fermer
  • Médecine et santé (5)
  • Sciences de la vie, biologie, biochimie (2)

Domaines :

Fullscreen

7 thèses pour "PTCHD1"

...GGTTCAGTGCTCAGGAAAGC 60PTCHD1F2 CCACGGTTCAGACCTTCATT 60PTCHD1R2 ACTGCGAGCCAGTCAAAGAT 60UPF3BF2 GCTCCAAGGGGGAAGATAAG 60...

Accéder en ligne
Sciences de la vie et de la santé

Soutenue le 27-11-2018
thèse soutenue

...excitatrices postsynaptiques TSA, schizophrénie, Phelan–McDermid syndrome. PTCHD1 Patched domain containing 1...

Accéder en ligne

...ERTNK 2−5SMC1BPPP4R4VAX1ANKRD18AF M201A95CCERS1LEC 8NOGFAM19A5P X6MACROD2TTPAAPBA1NGEFCHST6MAPK4PTCHD1SL...

Accéder en ligne

....Rare mutations in some X-linked genes such as NLGN3and NLGN413and the PTCHD1 locus (MIM 300828)49have been shown...

Accéder en ligne

...29953PSMD10 5716 SART3 9733 SSX1 6756 TRIM13 10206PTCHD1 139411 SBF1 6305 STAG1 10274 TRIM32 22954PTPN18...

Accéder en ligne

....2 PTCHD1 Xp22.11 GNB2L1 5q35.3 DLG2 11q14.1 MPP2 17q21.31 RPS6KA3 Xp22.12 HOMER1 5q14.1 GRM5 11q14.2-q14...

Accéder en ligne

Résultats 1 à 7