Résultats 1 à 10

Dates de soutenance :


Etablissements :

Valider et fermer
  • Normandie (5)
  • Paris Saclay (4)
  • Clermont-Ferrand 2 (3)
  • Grenoble (3)
  • Paris 6 (3)
  • Toulouse 3 (3)
  • Angers (2)
  • Clermont Auvergne (2)
  • Grenoble Alpes (2)
  • Université de Lorraine (2)
  • Académie des sciences de Russie (1)
  • Bordeaux (1)
  • Clermont-Ferrand 1 (1)
  • Lille 1 (1)
  • Lille 2 (1)
  • Lyon 1 (1)
  • Montpellier (1)
  • Nantes, Ecole nationale vétérinaire (1)
  • Paris 7 (1)
  • Rennes, Agrocampus Ouest (1)
  • Slovak University of Technology (1)
  • Sorbonne Paris Cité (1)
  • Strasbourg (1)
  • Toulouse, INSA (1)
  • Tours (1)
  • UNIVERSIDADEFEDERALDEMINASGERAIS, UFMG (1)

Etablissements :

Fullscreen

Disciplines :

Valider et fermer
  • Aspects moleculaires et cellulaires de la biologie (5)
  • Informatique (3)
  • Chimie (2)
  • Sciences de la vie (2)
  • Sciences de la vie et de la sante (2)
  • Biologie Santé (1)
  • Biologie cellulaire et moléculaire végétale (1)
  • Biologie des organismes, biotechnologies animales, végétales et microbiennes (1)
  • Biologie structurale et nanobiologie (1)
  • Biologie végétale (1)
  • Biotechnologie de génie des procédés environnement agroalimentaire (1)
  • Cancérologie (1)
  • Complexité du Vivant (1)
  • Génie des procédés (1)
  • Génie enzymatique, bioconversion et microbiologie (1)
  • Génétique et Physiologie (1)
  • Génétique moléculaire (1)
  • Géochimie et écotoxicologie (1)
  • Immunologie (1)
  • Ingenieries microbienne et enzymatique (1)
  • Innovation pharmacologique (1)
  • Microbiologie (1)
  • Nutrition et Sciences des aliments (1)
  • Physiologie et physiopathologie (1)
  • Physiologie, Physiopathologie thérapeutique (1)
  • Recherche clinique et innovation technologique (1)
  • Santé publique - recherche clinique (1)
  • Sciences agronomiques (1)
  • Sciences biologiques fondamentales et appliquées. Sciences médicales (1)
  • Sciences de la Vie et de la Santé (1)
  • Sciences de la vie et de la santé. Biologie cellulaire (1)
  • Sciences. Biochimie (1)
  • Virologie microbiologie immunologie (1)

Disciplines :

Fullscreen

Ecoles Doctorales :

Valider et fermer
  • École doctorale Normande de biologie intégrative, santé, environnement (Mont-Saint-Aignan, Seine-Maritime) (5)
  • École doctorale chimie et science du vivant (Grenoble) (5)
  • École doctorale des sciences de la vie, santé, agronomie, environnement (Clermont-Ferrand) (4)
  • École Doctorale Biologie Santé Biotechnologies (Toulouse) (2)
  • École doctorale Agriculture, Alimentation, Biologie, Environnement, Santé (Paris ; 2015-....) (2)
  • École doctorale IAEM Lorraine - Informatique, Automatique, Électronique - Électrotechnique, Mathématiques de Lorraine (2)
  • École doctorale Végétal-Environnement-Nutrition-Agro-Alimentaire-Mer (Angers) (2)
  • Ecole doctorale Santé, sciences, technologies (Tours) (1)
  • Ecole doctorale des sciences fondamentales (Clermont-Ferrand) (1)
  • Sciences Chimiques et Biologiques pour la Santé (1)
  • École Doctorale Sciences Écologiques, Vétérinaires, Agronomiques et Bioingénieries (Toulouse) (1)
  • École doctorale Biologie-Santé (Lille) (1)
  • École doctorale Bio Sorbonne Paris Cité (Paris) (1)
  • École doctorale Complexité du vivant (Paris) (1)
  • École doctorale Santé Publique (Le Kremlin-Bicêtre, Val-de-Marne ; 2015-...) (1)
  • École doctorale Sciences de la vie et de la santé (Strasbourg ; 2000-....) (1)
  • École doctorale Sciences et Environnements (Pessac, Gironde) (1)
  • École doctorale Sciences et technologies de l'information et de la communication (Orsay, Essonne ; 2015-....) (1)
  • École doctorale Vie-Agro-Santé (Rennes) (1)
  • École doctorale des sciences fondamentales (Clermont-Ferrand) (1)
  • École doctorale physiologie, physiopathologie et thérapeutique (1)
  • École doctorale Écologie Géosciences Agronomie Alimentation (Rennes) (1)

Ecoles Doctorales :

Fullscreen

Langues :

Valider et fermer
  • français (31)
  • anglais (14)
  • null (1)

Langues :

Fullscreen

Directeurs de thèse :

Valider et fermer
  • Deutscher Josef (2)
  • Devignes Marie-Dominique (2)
  • Feuilloley Marc (2)
  • Andrès Christian (1)
  • Antoine Bénédicte (1)
  • Azevedo Vasco (1)
  • Barnich Nicolas (1)
  • Boisbouvier Jérôme (1)
  • Boisseau Nathalie (1)
  • Boisset Sandrine (1)
  • Cattoir Vincent (1)
  • Chevalier-Laurency Sylvie (1)
  • Coulet Adrien (1)
  • Crépin Thibaut (1)
  • Delmas Julien (1)
  • Delort Anne-Marie (1)
  • Durel Charles-Éric (1)
  • Finazzi Giovanni (1)
  • Forano Claude (1)
  • Forano Évelyne (1)
  • Guérin Vincent (1)
  • Harbarth Stephan (1)
  • Jault Jean-Michel (1)
  • Langin Dominique (1)
  • Laroche Céline (1)
  • Le Loir Yves (1)
  • Lemaire Marielle (1)
  • Lothier Jérémy (1)
  • Léon Sébastien (1)
  • Mas Véronique de (1)
  • Massabuau Jean Charles (1)
  • Matulova Maria (1)
  • Monnet Christophe (1)
  • Montel Marie-Christine (1)
  • Netrusov Alexander Ivanovitch (1)
  • Pestel-Caron Martine (1)
  • Plevin Michael (1)
  • Portais Jean-Charles (1)
  • Prévost Gilles (1)
  • Rassendren François (1)
  • Renesto Patricia (1)
  • Reynaud Chantal (1)
  • Riegel Philippe (1)
  • Ritchie David (1)
  • Rossmeislova Lenka (1)
  • Schoehn Guy (1)
  • Tenaillon Olivier (1)
  • Tran Damien (1)
  • Vasseur Jacques (1)
  • Vian Alain (1)
  • Vigouroux Corinne (1)
  • Viguerie Nathalie (1)
  • Virolle Marie-Joëlle (1)
  • Yakoub-Agha Ibrahim (1)
  • Zagorec Monique (1)

Directeurs de thèse :

Fullscreen

Domaines :

Valider et fermer
  • Sciences de la vie, biologie, biochimie (27)
  • Médecine et santé (8)
  • Informatique (3)
  • Génie chimique, technologies alimentaires (3)
  • Chimie, minéralogie, cristallographie (2)
  • Agronomie, agriculture et médecine vétérinaire (2)
  • Sciences de la nature et mathématiques (1)
  • Sciences de la terre (1)
  • Sport (1)

Domaines :

Fullscreen

42 thèses pour "Glycérol kinase"

..._105443 0.57 0.86 1.15 2.18 Ga0116594_113327 0.60 0.62 0.41 0.75 Glycerol degradation via glycerol kinase...

Accéder en ligne

...facilitator protein, a glycerol kinase, a glycerol-3-phosphate (Gly3P) dehydrogenase and a conserved...

Accéder en ligne

...a glycerol kinase and a glycerol-3-P dehydrogenase. Then, the DHAP enters into glycolysis pathway...

Accéder en ligne
Aspects moleculaires et cellulaires de la biologie

Soutenue le 06-10-2017
thèse soutenue

...EFAU004_00377 glpK glycerol kinase glpKqRT-F AGCTGAAAAAGGCGAATTGA glpKqRT-R CCGACTGGCATTCGAGTAAT...

Accéder en ligne

...sequence of the genes encoding glycerol kinase (glpK) and glycerol-3-phosphate dehydrogenase (glp...

Accéder en ligne

Résultats 1 à 10